A general method for genotyping mast cell-deficient KITW/KIT mice by allele-specific polymerase chain reaction

M. Laig-Webster, L. M. Coussens, D. Hanahan, G. H. Caughey

Research output: Contribution to journalArticlepeer-review

1 Scopus citations

Abstract

In crossing standard C57BL6J-KitW-υ (Black) and WB/ReJ-KitW (White) heterozygotes to create the mast cell-deficient compound heterozygotes KitW / KitW-υ, coat color distinguishes the 4 possible genotypes. However, in many customized crosses into different strain backgrounds, coat color is not an indicator of genotype. To facilitate such crosses, we developed a PCR-based approach to identify KITW and KITW-υ single and compound heterozygotes. In this approach, the KITW and KITW-υ mutations are amplified but not normal DNA. DNA from 2-mm mouse tails is proteinase K digested and boiled in 0.5 ml. To trace the KITW mutation, we use primers for introns 9 and 10 of the mouse kit gene (CCAAGAGAAAGCTTTGTTCCCTGAATGTGC and AGAACAATTCAATGCTCAT). To trace the KITW-υ mutation, we use primers for exons 12 and 13 (CATTGGGAGCTGGTGCCTTCGGGAAGGT and AGACTACCTCCCACCA). 3 μl tail DNA are amplified with 2.5 U AmpliTaq Gold in a 50-μl reaction containing 10 pmol of each primer, 200 μM dNTPs and 1.5 mM MgCl2. The KITW mutation is detected by 1 cycle at 94°C for 5 min, 20 cycles at 94°C for 30 sec and 72°C for 1 min, 40 cycles at 94°C for 30 sec, 58°C for 1 min and 72°C for 30 sec. The KITW-υ mutation is detected by 1 cycle at 94°C for 5 min, 10 cycles at 94°C for 30 sec and 72°C for 1 min, 50 cycles at 94°C for 30 sec, 51°C for 1 min and 72°C for 30 sec. PCR results were verified by DNA sequencing. This assay is applicable to any experiment requiring KitW / KitW-υ genotyping.

Original languageEnglish (US)
Pages (from-to)A895
JournalFASEB Journal
Volume12
Issue number5
StatePublished - Mar 20 1998
Externally publishedYes

ASJC Scopus subject areas

  • Biotechnology
  • Biochemistry
  • Molecular Biology
  • Genetics

Fingerprint

Dive into the research topics of 'A general method for genotyping mast cell-deficient KITW/KIT mice by allele-specific polymerase chain reaction'. Together they form a unique fingerprint.

Cite this